str dna sequencing Search Results


90
IDEXX str dna sequencing
Str Dna Sequencing, supplied by IDEXX, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/str dna sequencing/product/IDEXX
Average 90 stars, based on 1 article reviews
str dna sequencing - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Sangon Biotech str-binding single-stranded dna (str1 aptamer sequence: 50- tagggaattcgtcgacggatccggggtctggtgttctgctttg ttctgtcgggtcgtctgcaggtcgacgcatgcgccg-30, 79-mer)
Str Binding Single Stranded Dna (Str1 Aptamer Sequence: 50 Tagggaattcgtcgacggatccggggtctggtgttctgctttg Ttctgtcgggtcgtctgcaggtcgacgcatgcgccg 30, 79 Mer), supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/str-binding single-stranded dna (str1 aptamer sequence: 50- tagggaattcgtcgacggatccggggtctggtgttctgctttg ttctgtcgggtcgtctgcaggtcgacgcatgcgccg-30, 79-mer)/product/Sangon Biotech
Average 90 stars, based on 1 article reviews
str-binding single-stranded dna (str1 aptamer sequence: 50- tagggaattcgtcgacggatccggggtctggtgttctgctttg ttctgtcgggtcgtctgcaggtcgacgcatgcgccg-30, 79-mer) - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

90
Institut Curie short tandem repeat (str) dna sequencing
Short Tandem Repeat (Str) Dna Sequencing, supplied by Institut Curie, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/short tandem repeat (str) dna sequencing/product/Institut Curie
Average 90 stars, based on 1 article reviews
short tandem repeat (str) dna sequencing - by Bioz Stars, 2026-04
90/100 stars
  Buy from Supplier

Image Search Results